Stem-loop sequence mml-mir-1232

DescriptionMacaca mulatta miR-1232 stem-loop
   --         -   c acauggcgggggcggcgggc 
5'   guggggugg cgg g                    c
     ||||||||| ||| |                     
3'   cgccccacc gcc c                    c
   ga         a   c aguccgcgugucggaggcgu 
Get sequence
Deep sequencing
1 reads, 0.0921 reads per million, 3 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 1246142-1246214 [+]
ENSMMUT00000030167 ; ABCA2-201; 3'UTR (exon 28)
Database links

Mature sequence mml-miR-1232

Accession MIMAT0005587

53 - 


 - 73

Get sequence
Evidence experimental; cloned [1]
Predicted targets


PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).