Stem-loop sequence hsa-mir-1231

AccessionMI0006321 (change log)
Symbol HGNC:MIR1231
DescriptionHomo sapiens miR-1231 stem-loop
Gene family MIPF0001309; mir-1231
Literature search

5 open access papers mention hsa-mir-1231
(5 sentences)

Stem-loop
   gucagugu   -   --      cu     aa    ---a    ---ca    u 
5'         cug ggc  ggacag  gcagg  aggg    agac     aggc u
           ||| |||  ||||||  |||||  ||||    ||||     |||| g
3'         gac ccg  cuuguc  ugucc  uccc    ucug     ucug c
   --------   a   uu      --     ca    accg    accug    u 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 201808611-201808702 [+]
sense
OTTHUMT00000087088 ; IPO9-001; intron 1
OTTHUMT00000087091 ; IPO9-004; intron 2
ENST00000361565 ; IPO9-001; intron 1
ENST00000464348 ; IPO9-004; intron 2
Database links

Mature sequence hsa-miR-1231

Accession MIMAT0005586
Sequence

5 - 

gugucugggcggacagcugc

 - 24

Get sequence
Deep sequencing21 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).