Stem-loop sequence mml-mir-1230

Accession MI0006320
Description Macaca mulatta miR-1230 stem-loop
Stem-loop
g    -u      au       ----ga g    g gu 
 uggg  gggggc  cucggag      g uggg g  g
 ||||  ||||||  |||||||      | |||| |   
 accc  uccucg  gagccuc      c accc c  u
g    uu      gc       aguagg g    g gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099548049615: 28162-28234 [+]
sense
ENSMMUT00000000657 ; MMU.4709-202; intron 2
ENSMMUT00000000656 ; MMU.4709-201; intron 3
Database links

Mature sequence mml-miR-1230

Accession MIMAT0005585
Sequence

1 - 

gugggugggggcaucucgga

 - 20

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).