Stem-loop sequence mml-mir-1230

Accession MI0006320
Description Macaca mulatta miR-1230 stem-loop
Stem-loop
   g    -u      au       ----ga g    g gu 
5'  uggg  gggggc  cucggag      g uggg g  g
    ||||  ||||||  |||||||      | |||| |   
3'  accc  uccucg  gagccuc      c accc c  u
   g    uu      gc       aguagg g    g gg 
Get sequence
Deep sequencing
24 reads, 1.03 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 149005985-149006057 [+]
intergenic
Database links

Mature sequence mml-miR-1230

Accession MIMAT0005585
Sequence

1 - 

gugggugggggcaucucgga

 - 20

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).