Stem-loop sequence hsa-mir-1229

AccessionMI0006319
Symbol HGNC:MIR1229
DescriptionHomo sapiens miR-1229 stem-loop
Stem-loop
   --     u     -u   gg     c   -gg   g 
5'   guggg agggu  ugg  gagag gug   cug g
     ||||| |||||  |||  ||||| |||   ||| g
3'   caccc ucccg  acc  cucuc cac   gac u
   ga     -     uc   -a     c   agg   u 
Get sequence
Deep sequencing
23 reads, 45.2 reads per million, 21 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 179798278-179798346 [-]
intergenic
Database links

Mature sequence hsa-miR-1229-5p

Accession MIMAT0022942
Sequence

1 - 

guggguaggguuugggggagagcg

 - 24

Get sequence
Evidence not experimental

Mature sequence hsa-miR-1229-3p

Accession MIMAT0005584
Previous IDshsa-miR-1229
Sequence

47 - 

cucucaccacugcccucccacag

 - 69

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).