Stem-loop sequence hsa-mir-1228

AccessionMI0006318 (change log)
Symbol HGNC:MIR1228
DescriptionHomo sapiens miR-1228 stem-loop
Gene family MIPF0000924; mir-1228
Literature search

18 open access papers mention hsa-mir-1228
(111 sentences)

Stem-loop
   ---gu        g        uggu    ggugg     g 
5'      gggcgggg caggugug    gggu     ccugc g
        |||||||| ||||||||    ||||     ||||| u
3'      cccgcucc guccacac    cccg     ggacg g
   gaccc        -        ---u    -----     a 
Get sequence
Deep sequencing
381 reads, 4.35 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 57194504-57194576 [+]
intergenic
Database links

Mature sequence hsa-miR-1228-5p

Accession MIMAT0005582
Previous IDshsa-miR-1228*
Sequence

1 - 

gugggcgggggcaggugugug

 - 21

Get sequence
Deep sequencing170 reads, 47 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence hsa-miR-1228-3p

Accession MIMAT0005583
Previous IDshsa-miR-1228
Sequence

52 - 

ucacaccugccucgcccccc

 - 71

Get sequence
Deep sequencing201 reads, 49 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).