Stem-loop sequence mml-mir-1227

AccessionMI0006317
DescriptionMacaca mulatta miR-1227 stem-loop
Gene family MIPF0000454; mir-1227
Stem-loop
guggggccaggcgguggugggcaccgcu    ug     ------   a   a     
                            gggg  ggcac      agc gcc ugca 
                            ||||  |||||      ||| ||| ||| g
                            cucc  ccgug      ucg cgg acga 
--------------------gaccccuu    ua     ccccag   a   -     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 2078348-2078435 [-]
sense
ENSMMUT00000025220 ; C19orf35-201; intron 1
Database links

Mature sequence mml-miR-1227

Accession MIMAT0005581
Sequence

1 - 

guggggccaggcgguggugg

 - 20

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).