Stem-loop sequence mml-mir-1226

Accession MI0006315
Description Macaca mulatta miR-1226 stem-loop
Gene family MIPF0000444; mir-1226
Stem-loop
   gug    c       c    a      a   ----g  a 
5'    aggg augcagg cugg uggggc gcu     gg u
      |||| ||||||| |||| |||||| |||     || g
3'    uccc ugugucc gacc acuccg ugg     cc g
   -ga    u       c    -      g   gaaaa  u 
Get sequence
Deep sequencing
3 reads, 0.158 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 89995587-89995661 [-]
antisense
ENSMMUT00000004367 ; LRRC2-201; intron 5
Database links

Mature sequence mml-miR-1226

Accession MIMAT0005579
Sequence

54 - 

ucaccagcccuguguucccuag

 - 75

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).