Stem-loop sequence mml-mir-1226

Accession MI0006315
Description Macaca mulatta miR-1226 stem-loop
Gene family MIPF0000444; mir-1226
Stem-loop
gug    c       c    a      a   ----g  a 
   aggg augcagg cugg uggggc gcu     gg u
   |||| ||||||| |||| |||||| |||     || g
   uccc ugugucc gacc acuccg ugg     cc g
-ga    u       c    -      g   gaaaa  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 88663201-88663275 [-]
sense
ENSMMUT00000005402 ; DHX30-201; intron 20
ENSMMUT00000005403 ; DHX30-202; intron 21
Database links

Mature sequence mml-miR-1226

Accession MIMAT0005579
Sequence

54 - 

ucaccagcccuguguucccuag

 - 75

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).