Stem-loop sequence ptr-mir-1226

AccessionMI0006314 (change log)
DescriptionPan troglodytes miR-1226 stem-loop
Gene family MIPF0000444; mir-1226
Stem-loop
   gug    c       c    a      a   ----g  a 
5'    aggg augcagg cugg uggggc gcu     gg u
      |||| ||||||| |||| |||||| |||     || g
3'    uccc ugugucc gacc acuccg ugg     cc g
   -ga    u       c    -      g   gaaaa  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 48892295-48892369 [+]
sense
ENSPTRT00000027823 ; DHX30-201; intron 19
Database links

Mature sequence ptr-miR-1226

Accession MIMAT0005578
Sequence

54 - 

ucaccagcccuguguucccuag

 - 75

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).