Stem-loop sequence hsa-mir-1226

AccessionMI0006313
Symbol HGNC:MIR1226
DescriptionHomo sapiens miR-1226 stem-loop
Gene family MIPF0000444; mir-1226
Stem-loop
   gug    c       c    a      a   ----g  a 
5'    aggg augcagg cugg uggggc gcu     gg u
      |||| ||||||| |||| |||||| |||     || g
3'    uccc ugugucc gacc acuccg ugg     cc g
   -ga    u       c    -      g   gaaaa  u 
Get sequence
Deep sequencing
49 reads, 105 reads per million, 22 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 47849555-47849629 [+]
sense
OTTHUMT00000346136 ; DHX30-004; intron 2
OTTHUMT00000257495 ; DHX30-001; intron 2
OTTHUMT00000346140 ; DHX30-008; intron 2
OTTHUMT00000346143 ; DHX30-011; intron 2
OTTHUMT00000346142 ; DHX30-010; intron 2
OTTHUMT00000346135 ; DHX30-003; intron 2
OTTHUMT00000346134 ; DHX30-002; intron 2
OTTHUMT00000346137 ; DHX30-005; intron 2
ENST00000472718 ; DHX30-004; intron 2
ENST00000445061 ; DHX30-001; intron 2
ENST00000476446 ; DHX30-008; intron 2
ENST00000415400 ; DHX30-011; intron 2
ENST00000492893 ; DHX30-010; intron 2
ENST00000395745 ; DHX30-003; intron 2
ENST00000441384 ; DHX30-002; intron 2
ENST00000348968 ; DHX30-005; intron 2
ENST00000446256 ; DHX30-201; intron 2
Database links

Mature sequence hsa-miR-1226-5p

Accession MIMAT0005576
Previous IDshsa-miR-1226*
Sequence

1 - 

gugagggcaugcaggccuggaugggg

 - 26

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-1226-3p

Accession MIMAT0005577
Previous IDshsa-miR-1226
Sequence

54 - 

ucaccagcccuguguucccuag

 - 75

Get sequence
Deep sequencing27 reads, 12 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).