Stem-loop sequence mml-mir-1225

Accession MI0006312
Description Macaca mulatta miR-1225 stem-loop
Gene family MIPF0000445; mir-1225
Stem-loop
g    ua    c   u   ---  gg  -ag  aca            
 uggg  cggc cag ggg   gg  ag   gg   cgcccugggcu 
 ||||  |||| ||| |||   ||  ||   ||   |||||||||| c
 accc  gccg guc ccc   uc  uc   cc   gugggacccgu 
g    cc    u   -   gag  ag  agg  gac            
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 2081737-2081826 [-]
sense
Database links

Mature sequence mml-miR-1225-5p

Accession MIMAT0005574
Sequence

1 - 

guggguacggcccaguggggg

 - 21

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

Mature sequence mml-miR-1225-3p

Accession MIMAT0005575
Sequence

68 - 

cugagccccugugccgcccccag

 - 90

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).