Stem-loop sequence mml-mir-1224

AccessionMI0006310
DescriptionMacaca mulatta miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Stem-loop
g      cuc         a   uggcgccgccggggccagg 
 ugagga   gggaggugg ggg                   c
 ||||||   ||||||||| |||                    
 acuccu   uccuccacc ccc                   g
g      cuc         -   cucuucgcucgaaucuguc 
Get sequence
Deep sequencing
12029 reads, 190 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 103887093-103887177 [-]
sense
Database links

Mature sequence mml-miR-1224-5p

Accession MIMAT0005570
Previous IDsmml-miR-1224
Sequence

1 - 

gugaggacucgggaggugg

 - 19

Get sequence
Deep sequencing25 reads, 4 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence mml-miR-1224-3p

Accession MIMAT0005571
Previous IDsmml-miR-1224*
Sequence

65 - 

ccccaccuccucucuccucag

 - 85

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).