Stem-loop sequence mml-mir-1224

Accession MI0006310
Description Macaca mulatta miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Stem-loop
g      cuc         a   uggcgccgccggggccagg 
 ugagga   gggaggugg ggg                   c
 ||||||   ||||||||| |||                    
 acuccu   uccuccacc ccc                   g
g      cuc         -   cucuucgcucgaaucuguc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 102429366-102429450 [-]
sense
ENSMMUT00000026643 ; VWA5B2-202; intron 13
ENSMMUT00000026641 ; VWA5B2-201; intron 14
Database links

Mature sequence mml-miR-1224-5p

Accession MIMAT0005570
Previous IDs mml-miR-1224
Sequence

1 - 

gugaggacucgggaggugg

 - 19

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

Mature sequence mml-miR-1224-3p

Accession MIMAT0005571
Previous IDs mml-miR-1224*
Sequence

65 - 

ccccaccuccucucuccucag

 - 85

Get sequence
Evidence experimental; cloned [17964270]

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).