Stem-loop sequence mml-mir-1224

AccessionMI0006310 (change log)
DescriptionMacaca mulatta miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Stem-loop
   g      cuc         a   uggcgccgccggggccagg 
5'  ugagga   gggaggugg ggg                   c
    ||||||   ||||||||| |||                    
3'  acuccu   uccuccacc ccc                   g
   g      cuc         -   cucuucgcucgaaucuguc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 108810737-108810821 [-]
sense
Database links

Mature sequence mml-miR-1224-5p

Accession MIMAT0005570
Previous IDsmml-miR-1224
Sequence

1 - 

gugaggacucgggaggugg

 - 19

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence mml-miR-1224-3p

Accession MIMAT0005571
Previous IDsmml-miR-1224*
Sequence

65 - 

ccccaccuccucucuccucag

 - 85

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).