Stem-loop sequence ptr-mir-1224

AccessionMI0006309 (change log)
DescriptionPan troglodytes miR-1224 stem-loop
Gene family MIPF0000440; mir-1224
Stem-loop
   g      cuc         a   u  u  cgccggggccgg 
5'  ugagga   gggaggugg ggg gg gc            g
    ||||||   ||||||||| ||| || ||            c
3'  acuccu   uccuccacc ccc cu cg            g
   g      cuc         c   u  u  cucgacuuuguc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 188230294-188230378 [+]
sense
ENSPTRT00000029239 ; VWA5B2-201; intron 19
Database links

Mature sequence ptr-miR-1224-5p

Accession MIMAT0005568
Sequence

1 - 

gugaggacucgggagguggagggu

 - 24

Get sequence
Evidence experimental; cloned [1]
Predicted targets

Mature sequence ptr-miR-1224-3p

Accession MIMAT0005569
Sequence

65 - 

ccccaccuccucucuccucag

 - 85

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).