Stem-loop sequence mmu-mir-1198

Accession MI0006306
Symbol MGI:Mir1198
Description Mus musculus miR-1198 stem-loop
Stem-loop 
uuuuuuuucuuuuguuuauuuugu   u     -u  u        u   ccu           --   uc 
                        uug gacag  ug cuguuaug guu   ggcuggcuugg  uac  a
                        ||| |||||  || |||||||| |||   |||||||||||  |||   
                        gac cuguc  ac gacgguac caa   ccgaucgaacc  aug  u
--------------------cucu   u     cu  u        u   ucu           cg   ug
Get sequence
Deep sequencing
21059 reads, 81 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 7807101-7807221 [+]
sense
OTTMUST00000043339 ; Gripap1-006; intron 7
OTTMUST00000043338 ; Gripap1-005; intron 10
OTTMUST00000043336 ; Gripap1-003; intron 11
OTTMUST00000043337 ; Gripap1-004; intron 12
OTTMUST00000043343 ; Gripap1-010; intron 13
OTTMUST00000043334 ; Gripap1-001; intron 13
OTTMUST00000043335 ; Gripap1-002; intron 14
ENSMUST00000135622 ; Gripap1-006; intron 7
ENSMUST00000140540 ; Gripap1-005; intron 10
ENSMUST00000136930 ; Gripap1-003; intron 11
ENSMUST00000101694 ; Gripap1-004; intron 12
ENSMUST00000132456 ; Gripap1-010; intron 13
ENSMUST00000065932 ; Gripap1-001; intron 13
ENSMUST00000115675 ; Gripap1-002; intron 14
Database links

Mature sequence mmu-miR-1198-5p

Accession MIMAT0005859
Previous IDs mmu-miR-1198
Sequence

42 -  

uauguguuccuggcuggcuugg

 - 63

Get sequence
Deep sequencing 20810 reads, 79 experiments
Evidence experimental; 454 [1], Solexa [2-3]
Predicted targets

Mature sequence mmu-miR-1198-3p

Accession MIMAT0017332
Sequence

80 -  

aagcuagccucuaacucauggc

 - 101

Get sequence
Deep sequencing 227 reads, 54 experiments
Evidence experimental; Solexa [3]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).