Stem-loop sequence mmu-mir-1197

AccessionMI0006305 (change log)
Symbol MGI:Mir1197
DescriptionMus musculus miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   gugagcuggaaucagccagcguuaccucaa      -u     ugc   u       gug g    - uuu 
5'                               gguauu  gaaga   ggu gaccaug   u uacg c   a
                                 ||||||  |||||   ||| |||||||   | |||| |   u
3'                               cuauaa  cuucu   uca cugguac   g augc g   u
   --------------------ccgcucuaca      cu     ---   u       aca g    a uau 
Get sequence
Deep sequencing
850 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109712317-109712436 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-1197
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-1197-5p

Accession MIMAT0017331
Previous IDsmmu-miR-1197*
Sequence

45 - 

cgguugaccaugguguguacg

 - 65

Get sequence
Deep sequencing25 reads, 13 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence mmu-miR-1197-3p

Accession MIMAT0005858
Previous IDsmmu-miR-1197
Sequence

80 - 

uaggacacauggucuacuucu

 - 100

Get sequence
Deep sequencing823 reads, 45 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).