Stem-loop sequence mmu-mir-1195

AccessionMI0006303 (change log)
Symbol MGI:Mir1195
DescriptionMus musculus miR-1195 stem-loop
Literature search

10 open access papers mention mmu-mir-1195
(37 sentences)

Stem-loop
   ----ua        caga        a    ga   ca    ----     ac 
5'       gaggcagg    ucucugug guuc  ggc  gccu    gcuca  a
         ||||||||    |||||||| ||||  |||  ||||    |||||   
3'       cucugucc    agagacac caag  ccg  cggg    ugagu  g
   gaagaa        -caa        a    ga   -a    aucu     aa 
Get sequence
Deep sequencing
10278 reads, 668 reads per million, 124 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 70860503-70860600 [-]
antisense
OTTMUST00000104222 ; RP23-85E24.2-002; intron 3
ENSMUST00000176549 ; Gm9320-002; intron 3
Database links

Mature sequence mmu-miR-1195

Accession MIMAT0005856
Sequence

21 - 

ugaguucgaggccagccugcuca

 - 43

Get sequence
Deep sequencing8620 reads, 102 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).