Stem-loop sequence mmu-mir-467h

AccessionMI0006302 (change log)
Symbol MGI:Mir467h
DescriptionMus musculus miR-467h stem-loop
Gene family MIPF0000316; mir-467
Literature search

18 open access papers mention mmu-mir-467h
(50 sentences)

Stem-loop
   uuuucacuuuuguuuuucucauguauaugug      ug g ug      au     c      ug   g    u 
5'                                uaugug  c g  uacaua  uauau uaugug  cau uaug g
                                  ||||||  | |  ||||||  ||||| ||||||  ||| ||||  
3'                                auacau  g u  gugugu  guaua guacgu  gug auac g
   -----------------------------ua      gu g gu      --     u      gu   a    a 
Get sequence
Deep sequencing
25642 reads, 145 reads per million, 107 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 115381819-115381939 [+]
intergenic
Database links

Mature sequence mmu-miR-467h

Accession MIMAT0005855
Sequence

80 - 

auaagugugugcauguauaugu

 - 101

Get sequence
Deep sequencing25381 reads, 101 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).