Stem-loop sequence mmu-mir-467g

AccessionMI0006301 (change log)
Symbol MGI:Mir467g
DescriptionMus musculus miR-467g stem-loop
Gene family MIPF0000316; mir-467
Literature search

18 open access papers mention mmu-mir-467g
(51 sentences)

Stem-loop
   gucu    c      au                    a                 acaua 
5'     ugug augcau  auauauauguguguguguau uauauauacauauauau     c
       |||| ||||||  |||||||||||||||||||| |||||||||||||||||      
3'     auau uaugua  uauauauauacacacacaua auauauauguauaugua     a
   --au    a      cu                    c                 cacau 
Get sequence
Deep sequencing
16189 reads, 113 reads per million, 120 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 34732853-34732972 [-]
antisense
OTTMUST00000056034 ; Grk4-004; intron 7
OTTMUST00000056031 ; Grk4-001; intron 11
ENSMUST00000153323 ; Grk4-004; intron 7
ENSMUST00000001112 ; Grk4-001; intron 11
Database links

Mature sequence mmu-miR-467g

Accession MIMAT0005854
Sequence

81 - 

uauacauacacacacauauau

 - 101

Get sequence
Deep sequencing15852 reads, 107 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).