Stem-loop sequence mmu-mir-669e

AccessionMI0006300 (change log)
Symbol MGI:Mir669e
DescriptionMus musculus miR-669e stem-loop
Gene family MIPF0000316; mir-467
Literature search

8 open access papers mention mmu-mir-669e
(11 sentences)

Stem-loop
   gccugggauucaugggcuguacccuauauaugggcag        -cuu       ca   ucauuu        gaa 
5'                                      gugugugu    gugugug  ugu      guguauau   u
                                        ||||||||    |||||||  |||      ||||||||    
3'                                      cacacacg    cacacau  aca      cacauaua   a
   --------------------------------acaca        uacu       uc   ------        agu 
Get sequence
Deep sequencing
8626 reads, 77.2 reads per million, 101 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10467495-10467613 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669e
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
Database links

Mature sequence mmu-miR-669e-5p

Accession MIMAT0005853
Previous IDsmmu-miR-669e
Sequence

43 - 

ugucuugugugugcauguucau

 - 64

Get sequence
Deep sequencing623 reads, 69 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-669e-3p

Accession MIMAT0017330
Previous IDsmmu-miR-669e*
Sequence

80 - 

ugaauauacacacacuuacac

 - 100

Get sequence
Deep sequencing137 reads, 47 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).