Stem-loop sequence mmu-mir-1193

AccessionMI0006298 (change log)
Symbol MGI:Mir1193
DescriptionMus musculus miR-1193 stem-loop
Gene family MIPF0000714; mir-1193
Literature search

3 open access papers mention mmu-mir-1193
(3 sentences)

Stem-loop
   cugaagggacaaugaugcccac  u   cg    a c  u            - c      g    - uuc 
5'                       ug ucu  gggu g ug guggaugguaga c ggugac uaca c   a
                         || |||  |||| | || |||||||||||| | |||||| |||| |   u
3'                       ac aga  ccca c ac caccuaucauuu g ccacug augu g   u
   ------------------gucu  c   --    - a  -            u c      g    c uau 
Get sequence
Deep sequencing
3669 reads, 16.9 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109715671-109715791 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-1193
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
Database links

Mature sequence mmu-miR-1193-5p

Accession MIMAT0017329
Sequence

46 - 

ugguagaccggugacguaca

 - 65

Get sequence
Deep sequencing1000 reads, 48 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-1193-3p

Accession MIMAT0005851
Previous IDsmmu-miR-1193
Sequence

80 - 

uaggucacccguuuuacuauc

 - 100

Get sequence
Deep sequencing2650 reads, 54 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).