Stem-loop sequence mmu-mir-1192

AccessionMI0006297 (change log)
Symbol MGI:Mir1192
DescriptionMus musculus miR-1192 stem-loop
Literature search

4 open access papers mention mmu-mir-1192
(10 sentences)

Stem-loop
   ----------------------   -  -    -  g     a            c   c      -ugu  u 
5'                       ccu uc caaa ca uaaaa caaacaaacaaa aga caaauu    ca u
                         ||| || |||| || ||||| |||||||||||| ||| ||||||    ||  
3'                       gga ag guuu gu guuuu guuuguuuguuu ucu guuuag    gu g
   cguacucgauauguucggucug   c  a    u  -     c            u   c      cuuu  u 
Get sequence
Deep sequencing
216 reads, 126 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 23149431-23149551 [+]
sense
ENSMUST00000036884 ; Klf9-201; intron 1
Database links

Mature sequence mmu-miR-1192

Accession MIMAT0005850
Sequence

20 - 

aaacaaacaaacagaccaaauu

 - 41

Get sequence
Deep sequencing91 reads, 50 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).