Stem-loop sequence mmu-mir-466j

AccessionMI0006295 (change log)
Symbol MGI:Mir466j
DescriptionMus musculus miR-466j stem-loop
Gene family MIPF0000316; mir-467
Literature search

25 open access papers mention mmu-mir-466j
(62 sentences)

Stem-loop
        ug           ucgugugu   ug      ug      ug     u      ug g 
5' gugug  ugugugugcau        uug  caugug  uaugug  cacau uaugug  u c
   |||||  |||||||||||        |||  ||||||  ||||||  ||||| ||||||  |  
3' cauac  guauauaugug        aau  guguac  guacgu  gugug auguau  g a
        gu           ------uu   gu      gu      gu     u      gu u 
Get sequence
Deep sequencing
9676 reads, 855 reads per million, 124 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 60960723-60960844 [+]
intergenic
Database links

Mature sequence mmu-miR-466j

Accession MIMAT0005848
Sequence

80 - 

ugugugcaugugcauguguguaa

 - 102

Get sequence
Deep sequencing9380 reads, 99 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).