Stem-loop sequence mmu-mir-1190

AccessionMI0006294 (change log)
Symbol MGI:Mir1190
DescriptionMus musculus miR-1190 stem-loop
Literature search

1 open access papers mention mmu-mir-1190
(3 sentences)

Stem-loop
   -    u     --cu  g      u   aa gu   u      --cu  u 
5'  gcuc ggggc    uu cagacg ggg  g  cuc gcuggc    ga g
    |||| |||||    || |||||| |||  |  ||| ||||||    ||  
3'  ugag uuccg    ag gucugu ucc  u  gag cgacug    cu c
   c    -     ucgu  g      c   cc ug   u      cccc  u 
Get sequence
Deep sequencing
14 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 101021673-101021768 [-]
sense
ENSMUST00000068411 ; Ccdc88c-201; intron 3
ENSMUST00000085096 ; Ccdc88c-202; intron 3
Database links

Mature sequence mmu-miR-1190

Accession MIMAT0005847
Sequence

56 - 

ucagcugagguuccccucuguc

 - 77

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).