Stem-loop sequence mmu-mir-467f

AccessionMI0006293 (change log)
Symbol MGI:Mir467f
DescriptionMus musculus miR-467f stem-loop
Gene family MIPF0000316; mir-467
Literature search

19 open access papers mention mmu-mir-467f
(53 sentences)

Stem-loop
   acggcuacauagagaaauccuguacccagaaaucgaacgggggugggug                          u 
5'                                                  uguguguagguguguguguguguaug a
                                                    ||||||||||||||||||||||||||  
3'                                                  acacacauccacacacacacauauau u
   ----------------------------------uuuaagguuuuuucg                          g 
Get sequence
Deep sequencing
14847 reads, 1.68e+03 reads per million, 145 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 69635400-69635519 [-]
antisense
OTTMUST00000013449 ; Fxr2-006; intron 1
ENSMUST00000018909 ; Fxr2-006; intron 1
Database links

Mature sequence mmu-miR-467f

Accession MIMAT0005846
Sequence

81 - 

auauacacacacacaccuaca

 - 101

Get sequence
Deep sequencing13915 reads, 110 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).