Stem-loop sequence mmu-mir-466k

AccessionMI0006292 (change log)
Symbol MGI:Mir466k
DescriptionMus musculus miR-466k stem-loop
Gene family MIPF0000208; mir-466
Literature search

22 open access papers mention mmu-mir-466k
(59 sentences)

Stem-loop
   auau   ug  ug      ug              --      ag    ug           u 
5'     aug  ug  ugugug  uguguguacaugua  caugug  uaug  uguguauaugu u
       |||  ||  ||||||  ||||||||||||||  ||||||  ||||  |||||||||||  
3'     ugu  ac  guacgu  guauauguguauau  guguau  gugu  guacguguaca g
   ----   gu  gu      gu              aa      ga    gu           u 
Get sequence
Deep sequencing
5526 reads, 3.44e+03 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 85467377-85467498 [+]
antisense
OTTMUST00000081442 ; Arfip1-004; intron 3
ENSMUST00000154148 ; Arfip1-004; intron 3
Database links

Mature sequence mmu-miR-466k

Accession MIMAT0005845
Sequence

20 - 

uguguguguacauguacauguga

 - 42

Get sequence
Deep sequencing2737 reads, 127 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).