Stem-loop sequence mmu-mir-466f-4

AccessionMI0006291 (change log)
Symbol MGI:Mir466f-4
DescriptionMus musculus miR-466f-4 stem-loop
Gene family MIPF0000208; mir-466
Literature search

28 open access papers mention mmu-mir-466f-4
(67 sentences)

Stem-loop
   -------   cu    cugu   uc   ----     u       ug        ug   -  gu 
5'        cau  gcau    gug  uac    gugug gugcaug  caugugug  uau cu  a
          |||  ||||    |||  |||    ||||| |||||||  ||||||||  ||| ||  u
3'        gua  ugug    cau  gug    uauau uacgugu  guacguac  gug ga  g
   uauacgu   ag    uguu   cu   uguc     c       gu        gu   u  gu 
Get sequence
Deep sequencing
2710 reads, 648 reads per million, 94 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 71107089-71107209 [+]
intergenic
Database links

Mature sequence mmu-miR-466f

Accession MIMAT0005844
Sequence

20 - 

acgugugugugcaugugcaugu

 - 41

Get sequence
Deep sequencing2614 reads, 88 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).