Stem-loop sequence mmu-mir-1188

AccessionMI0006290 (change log)
Symbol MGI:Mir1188
DescriptionMus musculus miR-1188 stem-loop
Gene family MIPF0001188; mir-1188
Literature search

2 open access papers mention mmu-mir-1188
(9 sentences)

Stem-loop
   ---------------------auacucac     - -c    -u      ag uu     -a   u  aa c 
5'                              agucu c  cagc  ggugug  g  gggcc  gga ga  c c
                                ||||| |  ||||  ||||||  |  |||||  ||| ||  |  
3'                              ucaga g  gucg  ccacac  c  cucgg  ccu cu  g a
   gguguggugagccgugucggaacgauccg     a uc    uc      ca cc     ag   -  cg a 
Get sequence
Deep sequencing
1497 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109611822-109611941 [+]
sense
OTTMUST00000113328 ; Rian-010; intron 2
OTTMUST00000113329 ; Rian-012; intron 2
ENSMUST00000183215 ; Rian-010; intron 2
ENSMUST00000182689 ; Rian-012; intron 2
Clustered miRNAs
< 10kb from mmu-mir-1188
mmu-mir-341chr12: 109611500-109611595 [+]
mmu-mir-1188chr12: 109611822-109611941 [+]
mmu-mir-370chr12: 109618258-109618336 [+]
Database links

Mature sequence mmu-miR-1188-5p

Accession MIMAT0005843
Previous IDsmmu-miR-1188
Sequence

20 - 

uggugugagguugggccagga

 - 40

Get sequence
Deep sequencing1460 reads, 50 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-1188-3p

Accession MIMAT0017328
Previous IDsmmu-miR-1188*
Sequence

56 - 

uccgaggcuccccaccacacccugc

 - 80

Get sequence
Deep sequencing19 reads, 12 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).