Stem-loop sequence mmu-mir-669f

AccessionMI0006287 (change log)
Symbol MGI:Mir669f
DescriptionMus musculus miR-669f stem-loop
Gene family MIPF0000316; mir-467
Literature search

13 open access papers mention mmu-mir-669f
(25 sentences)

Stem-loop
   -------------------------   a     c     g    gu        c     c        au 
5'                          ugu ugugc ugugu uaua  ugugugug augug augugugu  a
                            ||| ||||| ||||| ||||  |||||||| ||||| ||||||||   
3'                          aca acacg acgca auau  acacacac uacau uacauaua  u
   aguugcucacgguaaggagacacac   a     a     a    gc        a     a        ag 
Get sequence
Deep sequencing
144737 reads, 858 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10467229-10467349 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669f
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
Database links

Mature sequence mmu-miR-669f-5p

Accession MIMAT0017327
Sequence

20 - 

aguugugugugcaugugcaugugu

 - 43

Get sequence
Deep sequencing125677 reads, 105 experiments
Evidence experimental; 454 [2], Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-669f-3p

Accession MIMAT0005839
Previous IDsmmu-miR-669f
Sequence

57 - 

cauauacauacacacacacguau

 - 79

Get sequence
Deep sequencing18890 reads, 103 experiments
Evidence experimental; 454 [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).