|
miRBase |
|
Mature sequence mmu-miR-669f-5p |
|
| Accession | MIMAT0017327 |
| Sequence |
20 - aguugugugugcaugugcaugugu - 43 |
| Evidence | experimental; 454 [2], Solexa [3] |
| Predicted targets |
|
Mature sequence mmu-miR-669f-3p |
|
| Accession | MIMAT0005839 |
| Previous IDs | mmu-miR-669f |
| Sequence |
57 - cauauacauacacacacacguau - 79 |
| Evidence | experimental; 454 [1], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
| 2 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|