Stem-loop sequence mmu-mir-1187

AccessionMI0006285 (change log)
Symbol MGI:Mir1187
DescriptionMus musculus miR-1187 stem-loop
Literature search

9 open access papers mention mmu-mir-1187
(47 sentences)

Stem-loop
   ucauauaguauuaaaccga        ccuuaua    caauuuauu          c               u 
5'                    acuguuuu       gaca         uuuacacaca acacacacacauaua a
                      ||||||||       ||||         |||||||||| |||||||||||||||  
3'                    ugauaaaa       uugu         aaaugugugu uguguguguguauau u
   ------------------a        -------    ---aacaau          a               a 
Get sequence
Deep sequencing
3417 reads, 5.11e+03 reads per million, 162 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 82798944-82799065 [-]
intergenic
Database links

Mature sequence mmu-miR-1187

Accession MIMAT0005837
Sequence

80 - 

uauguguguguguauguguguaa

 - 102

Get sequence
Deep sequencing910 reads, 118 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).