Stem-loop sequence mmu-mir-1b

AccessionMI0006283 (change log)
Previous IDsmmu-mir-1-2-as
Symbol MGI:Mir1b
DescriptionMus musculus miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

283 open access papers mention mmu-mir-1b
(2805 sentences)

Stem-loop
   uuccuuuagcuucuucuug    acauua     c  a a              -cau      -gc  u 
5'                    gcgg      ccuac ca a uacauacuucuuua    uccaua   ac g
                      ||||      ||||| || | ||||||||||||||    ||||||   || a
3'                    cguc      ggaug gu u guguaugaagaaau    ggguau   ug a
   ------------------g    -cucac     a  c c              acau      acu  u 
Get sequence
Deep sequencing
283 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Calabrese et al. report the detection of mature products from the antisense strand of mouse mir-1-2, at lower abundance than sense miR-1 [1].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 10785446-10785567 [+]
sense
OTTMUST00000070818 ; Mib1-004; intron 5
OTTMUST00000070815 ; Mib1-001; intron 12
ENSMUST00000124288 ; Mib1-004; intron 5
ENSMUST00000052838 ; Mib1-001; intron 12
ENSMUST00000165555 ; Mib1-201; intron 13
antisense
OTTMUST00000111849 ; RP24-66N1.1-001; intron 1
ENSMUST00000179771 ; Gm21747-001; intron 1
Clustered miRNAs
< 10kb from mmu-mir-1b
mmu-mir-133a-1chr18: 10782909-10782976 [-]
mmu-mir-1bchr18: 10785446-10785567 [+]
mmu-mir-1a-2chr18: 10785481-10785552 [-]
Database links

Mature sequence mmu-miR-1b-5p

Accession MIMAT0005835
Previous IDsmmu-miR-1-2-as;mmu-miR-1-2-as-5p
Sequence

41 - 

uacauacuucuuuacauucca

 - 61

Get sequence
Deep sequencing32 reads, 18 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-1b-3p

Accession MIMAT0017326
Previous IDsmmu-miR-1-2-as-3p
Sequence

80 - 

uggguacauaaagaaguaugugc

 - 102

Get sequence
Deep sequencing249 reads, 54 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).