Stem-loop sequence mmu-mir-466i

AccessionMI0006282 (change log)
Symbol MGI:Mir466i
DescriptionMus musculus miR-466i stem-loop
Gene family MIPF0000316; mir-467
Literature search

32 open access papers mention mmu-mir-466i
(77 sentences)

Stem-loop
   agagaucaugucagugaacugccacauuuuuga       ua           -                     u 
5'                                  uauauau  uguauguaugu gugugugugugugugugugua a
                                    |||||||  ||||||||||| |||||||||||||||||||||  
3'                                  auauaua  acguauguaca cacacauacacacacacauau u
   --------------------------------c       ca           u                     a 
Get sequence
Deep sequencing
12927 reads, 4.99e+03 reads per million, 163 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 17747473-17747593 [+]
antisense
ENSMUST00000042365 ; Cdk13-201; intron 7
Database links

Mature sequence mmu-miR-466i-5p

Accession MIMAT0017325
Sequence

53 - 

ugugugugugugugugugug

 - 72

Get sequence
Deep sequencing2281 reads, 147 experiments
Evidence experimental; 454 [2]
Predicted targets

Mature sequence mmu-miR-466i-3p

Accession MIMAT0005834
Previous IDsmmu-miR-466i
Sequence

80 - 

auacacacacacauacacacua

 - 101

Get sequence
Deep sequencing10292 reads, 154 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).