Stem-loop sequence mmu-mir-669g

AccessionMI0006280 (change log)
Symbol MGI:Mir669g
DescriptionMus musculus miR-669g stem-loop
Gene family MIPF0000316; mir-467
Literature search

9 open access papers mention mmu-mir-669g
(12 sentences)

Stem-loop
   ----------------------------------------ca        uacu    u      ---   a      gac   a 
5'                                           ugugugcu    ugua gugcau   ugu uguguu   aug u
                                             ||||||||    |||| ||||||   ||| ||||||   ||| a
3'                                           acacacga    acgu uaugug   aca auacaa   uac u
   uauaguaaguuugcauauuuacuuacguuaaaaaggacacac        ----    c      cac   a      ---   a 
Get sequence
Deep sequencing
3986 reads, 100 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10477150-10477272 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669g
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
Database links

Mature sequence mmu-miR-669g

Accession MIMAT0005832
Sequence

21 - 

ugcauuguauguguugacaugau

 - 43

Get sequence
Deep sequencing22 reads, 9 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).