Stem-loop sequence mmu-mir-669k

AccessionMI0006279 (change log)
Symbol MGI:Mir669k
DescriptionMus musculus miR-669k stem-loop
Gene family MIPF0000316; mir-467
   -----------------ucuuau   -ca  -aaa     ----            aguugu           cuuc 
5'                        gcc   cc    aaugu    gcauguguguau      gugcauauuca    u
                          |||   ||    |||||    ||||||||||||      |||||||||||     
3'                        cgg   gg    uuaca    cguacgcacaua      uacguauaagu    c
   gaggauugacucuauaucgagac   uaa  auac     caaa            ------           auau 
Get sequence
Deep sequencing
584 reads, 0 reads per million, 40 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10475300-10475426 [+]
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669k
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
Database links

Mature sequence mmu-miR-669k-5p

Accession MIMAT0017323
Previous IDsmmu-miR-669k*

19 - 


 - 43

Get sequence
Deep sequencing285 reads, 31 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-669k-3p

Accession MIMAT0005831
Previous IDsmmu-miR-669k

65 - 


 - 85

Get sequence
Deep sequencing288 reads, 32 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets


PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).