Stem-loop sequence mmu-mir-669k

AccessionMI0006279 (change log)
Symbol MGI:Mir669k
DescriptionMus musculus miR-669k stem-loop
Gene family MIPF0000316; mir-467
Literature search

11 open access papers mention mmu-mir-669k
(28 sentences)

Stem-loop
   -----------------ucuuau   -ca  -aaa     ----            aguugu           cuuc 
5'                        gcc   cc    aaugu    gcauguguguau      gugcauauuca    u
                          |||   ||    |||||    ||||||||||||      |||||||||||     
3'                        cgg   gg    uuaca    cguacgcacaua      uacguauaagu    c
   gaggauugacucuauaucgagac   uaa  auac     caaa            ------           auau 
Get sequence
Deep sequencing
633 reads, 75.9 reads per million, 54 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10475300-10475426 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-669k
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
Database links

Mature sequence mmu-miR-669k-5p

Accession MIMAT0017323
Previous IDsmmu-miR-669k*
Sequence

19 - 

ugugcauguguguauaguugugugc

 - 43

Get sequence
Deep sequencing324 reads, 43 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-669k-3p

Accession MIMAT0005831
Previous IDsmmu-miR-669k
Sequence

65 - 

uaugcauauacacgcaugcaa

 - 85

Get sequence
Deep sequencing297 reads, 39 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).