Stem-loop sequence mmu-mir-466l

AccessionMI0006278 (change log)
Symbol MGI:Mir466l
DescriptionMus musculus miR-466l stem-loop
Gene family MIPF0000316; mir-467
Literature search

24 open access papers mention mmu-mir-466l
(58 sentences)

Stem-loop
   ---------------------cua  ua            uu       a      ca     a     a 
5'                         ug  ugugcaugugug  ugugugu caugua  uguau uauau u
                           ||  ||||||||||||  ||||||| ||||||  ||||| |||||  
3'                         ac  acacguacguac  auacaca guacau  auaua auaua u
   ccuagauucucacgguaauuacac  gc            uu       c      aa     c     g 
Get sequence
Deep sequencing
1132 reads, 33.8 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10516097-10516217 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466l
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
mmu-mir-669hchr2: 10518155-10518279 [+]
Database links

Mature sequence mmu-miR-466l-5p

Accession MIMAT0017322
Sequence

21 - 

uuguguguacauguacauguau

 - 42

Get sequence
Deep sequencing809 reads, 54 experiments
Evidence experimental; 454 [2], Illumina [3]
Predicted targets

Mature sequence mmu-miR-466l-3p

Accession MIMAT0005830
Previous IDsmmu-miR-466l
Sequence

60 - 

uauaaauacaugcacacauauu

 - 81

Get sequence
Deep sequencing117 reads, 43 experiments
Evidence experimental; 454 [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).