Stem-loop sequence hsa-mir-1183

AccessionMI0006276 (change log)
Symbol HGNC:MIR1183
DescriptionHomo sapiens miR-1183 stem-loop
Gene family MIPF0000668; mir-1183
Stem-loop
   au     aaa     g a -a   agaa     ga aag    ga 
5'   uauuc   ugcuc g g  cac    cauua  g   acag  g
     |||||   ||||| | |  |||    |||||  |   ||||  u
3'   gugag   acgag u c  gug    guggu  u   uguc  u
   cc     --g     g a gg   -aga     ag gga    ac 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 21471058-21471146 [+]
sense
OTTHUMT00000326783 ; SP4-004; intron 1
OTTHUMT00000326588 ; SP4-002; intron 2
OTTHUMT00000211617 ; SP4-001; intron 3
ENST00000432066 ; SP4-004; intron 1
ENST00000448246 ; SP4-002; intron 2
ENST00000222584 ; SP4-001; intron 3
Database links

Mature sequence hsa-miR-1183

Accession MIMAT0005828
Sequence

48 - 

cacuguaggugauggugagagugggca

 - 74

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).