Stem-loop sequence hsa-mir-1182

AccessionMI0006275 (change log)
Symbol HGNC:MIR1182
DescriptionHomo sapiens miR-1182 stem-loop
Gene family MIPF0000673; mir-1182
Stem-loop
      a   g   cu  cu   u c      u    cagc    gga       g 
5' ggg cuu uca  gc  guc c ucccuc ccag    gacu   uucugga u
   ||| ||| |||  ||  ||| | |||||| ||||    ||||   ||||||| c
3' ccc gaa ggu  ug  cag g agggag gguu    cugg   gagaucu c
      -   g   --  -u   u u      -    ----    ---       a 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 231019828-231019924 [-]
intergenic
Database links

Mature sequence hsa-miR-1182

Accession MIMAT0005827
Sequence

62 - 

gagggucuugggagggaugugac

 - 84

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).