Stem-loop sequence hsa-mir-1181

AccessionMI0006274 (change log)
Symbol HGNC:MIR1181
DescriptionHomo sapiens miR-1181 stem-loop
Gene family MIPF0000665; mir-1181
Literature search

6 open access papers mention hsa-mir-1181
(8 sentences)

Stem-loop
   u    -     ----        --   ---  ca   g    gg 
5'  ccac ugcug    ccgccguc  gcc   gc  ccc agcc  a
    |||| |||||    ||||||||  |||   ||  ||| ||||   
3'  ggug gcgac    ggugguag  cgg   cg  ggg ucgg  g
   g    u     auca        aa   aac  cc   -    gc 
Get sequence
Deep sequencing
159 reads, 3.17 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10403458-10403538 [-]
antisense
OTTHUMT00000451221 ; ICAM5-002; exon 3
OTTHUMT00000451217 ; ICAM5-001; 3'UTR (exon 5)
ENST00000586480 ; ICAM5-002; exon 3
ENST00000221980 ; ICAM5-001; 3'UTR (exon 5)
Database links

Mature sequence hsa-miR-1181

Accession MIMAT0005826
Sequence

14 - 

ccgucgccgccacccgagccg

 - 34

Get sequence
Deep sequencing17 reads, 14 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).