Stem-loop sequence hsa-mir-1180

Accession MI0006273
Symbol HGNC:MIR1180
Description Homo sapiens miR-1180 stem-loop
Gene family MIPF0000789; mir-1180
Stem-loop 
        ---      c  -          gu  u 
gcugcugg   acccac cg gccgggaaua  gc c
||||||||   |||||| || ||||||||||  || c
cggcggcu   ugggug gc cggccuuugu  ug u
        gug      c  u          --  g
Get sequence
Deep sequencing
158 reads, 20 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 19247819-19247887 [-]
sense
OTTHUMT00000132501 ; B9D1-008; intron 5
OTTHUMT00000132499 ; B9D1-006; intron 5
OTTHUMT00000132494 ; B9D1-001; intron 5
OTTHUMT00000132495 ; B9D1-002; intron 5
OTTHUMT00000132498 ; B9D1-005; intron 5
OTTHUMT00000440945 ; B9D1-014; intron 5
OTTHUMT00000132501 ; B9D1-008; intron 5
OTTHUMT00000132499 ; B9D1-006; intron 5
OTTHUMT00000132494 ; B9D1-001; intron 5
OTTHUMT00000132495 ; B9D1-002; intron 5
OTTHUMT00000132498 ; B9D1-005; intron 5
OTTHUMT00000440946 ; B9D1-013; intron 5
OTTHUMT00000440945 ; B9D1-014; intron 5
OTTHUMT00000132501 ; B9D1-008; intron 5
OTTHUMT00000132499 ; B9D1-006; intron 5
OTTHUMT00000132494 ; B9D1-001; intron 5
OTTHUMT00000132495 ; B9D1-002; intron 5
OTTHUMT00000132498 ; B9D1-005; intron 5
OTTHUMT00000440946 ; B9D1-013; intron 5
ENST00000461069 ; B9D1-008; intron 5
ENST00000395615 ; B9D1-006; intron 5
ENST00000261499 ; B9D1-001; intron 5
ENST00000477478 ; B9D1-002; intron 5
ENST00000395616 ; B9D1-005; intron 5
ENST00000575403 ; B9D1-014; intron 5
ENST00000461069 ; B9D1-008; intron 5
ENST00000395615 ; B9D1-006; intron 5
ENST00000261499 ; B9D1-001; intron 5
ENST00000477478 ; B9D1-002; intron 5
ENST00000395616 ; B9D1-005; intron 5
ENST00000575478 ; B9D1-013; intron 5
ENST00000575403 ; B9D1-014; intron 5
ENST00000461069 ; B9D1-008; intron 5
ENST00000395615 ; B9D1-006; intron 5
ENST00000261499 ; B9D1-001; intron 5
ENST00000477478 ; B9D1-002; intron 5
ENST00000395616 ; B9D1-005; intron 5
ENST00000575478 ; B9D1-013; intron 5
Database links

Mature sequence hsa-miR-1180

Accession MIMAT0005825
Sequence

41 -  

uuuccggcucgcgugggugugu

 - 62

Get sequence
Deep sequencing 146 reads, 19 experiments
Evidence experimental; cloned [1], 454 [2]
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).
2
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).