Stem-loop sequence hsa-mir-1180

AccessionMI0006273 (change log)
Symbol HGNC:MIR1180
DescriptionHomo sapiens miR-1180 stem-loop
Gene family MIPF0000789; mir-1180
Literature search

9 open access papers mention hsa-mir-1180
(84 sentences)

Stem-loop
           ---      c  -          gu  u 
5' gcugcugg   acccac cg gccgggaaua  gc c
   ||||||||   |||||| || ||||||||||  || c
3' cggcggcu   ugggug gc cggccuuugu  ug u
           gug      c  u          --  g 
Get sequence
Deep sequencing
16736 reads, 103 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 19344506-19344574 [-]
sense
OTTHUMT00000132553 ; AC004448.5-001; intron 2
ENST00000456537 ; AC004448.5-001; intron 2
Database links

Mature sequence hsa-miR-1180-5p

Accession MIMAT0026735
Sequence

7 - 

ggacccacccggccgggaaua

 - 27

Get sequence
Deep sequencing245 reads, 49 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-1180-3p

Accession MIMAT0005825
Sequence

41 - 

uuuccggcucgcgugggugugu

 - 62

Get sequence
Deep sequencing16487 reads, 151 experiments
Evidence experimental; cloned [1], 454 [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).
2
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).