Stem-loop sequence mcmv-mir-m108-1

Accession MI0006262
Description Mouse cytomegalovirus miR-m108-1 stem-loop
Stem-loop 
--  uu       a    c c      -ug  uc     ccucgu     a     a 
  cg  cacgagc accg c gaaaug   gg  uuccg      uacgc cgugu a
  ||  ||||||| |||| | ||||||   ||  |||||      ||||| |||||  
  gc  gugcucg uggc g cuuugc   cc  gaggc      augcg gcaua g
ga  -u       g    a u      uug  uc     ------     -     u
Get sequence

Mature sequence mcmv-miR-m108-1-5p

Accession MIMAT0005557
Previous IDs mcmv-miR-m108-1*
Sequence

4 -  

ucacgagcaaccgcccgaaaug

 - 25

Get sequence
Evidence experimental; cloned [1]

Mature sequence mcmv-miR-m108-1-3p

Accession MIMAT0005558
Previous IDs mcmv-miR-m108-1
Sequence

82 -  

uuucugacgguggcucgugucg

 - 103

Get sequence
Evidence experimental; cloned [1-2]

References

1
PMID:17928340 "Discrete clusters of virus-encoded micrornas are associated with complementary strands of the genome and the 7.2-kilobase stable intron in murine cytomegalovirus" Buck AH, Santoyo-Lopez J, Robertson KA, Kumar DS, Reczko M, Ghazal P J Virol. 81:13761-13770(2007).
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).