Stem-loop sequence mcmv-mir-m21-1

Accession MI0006250
Description Mouse cytomegalovirus miR-m21-1 stem-loop
Gene family MIPF0000453; mir-m21-1
Stem-loop 
    c      c  a g    c    ------------   a 
cccc gcuuga cg g cccc aucg            ugc c
|||| |||||| || | |||| ||||            |||  
gggg cgaacu gc c gggg uagc            acg a
    c      u  a a    a    caccaucaaaug   c
Get sequence

Mature sequence mcmv-miR-m21-1

Accession MIMAT0005540
Sequence

51 -  

auaggggacacguucaagccg

 - 71

Get sequence
Evidence experimental; cloned [1-2]

References

1
PMID:17928340 "Discrete clusters of virus-encoded micrornas are associated with complementary strands of the genome and the 7.2-kilobase stable intron in murine cytomegalovirus" Buck AH, Santoyo-Lopez J, Robertson KA, Kumar DS, Reczko M, Ghazal P J Virol. 81:13761-13770(2007).
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).