Stem-loop sequence aga-mir-34

AccessionMI0006239 (change log)
DescriptionAnopheles gambiae miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

4 open access papers mention aga-mir-34
(8 sentences)

Stem-loop
   gag   auaua   uc      u    u   c        ----   u 
5'    gca     cgc  uggcag gugg uag ugguugug    ugg u
      |||     |||  |||||| |||| ||| ||||||||    ||| u
3'    cgu     gcg  gccguc cgcc auc accgacac    acc u
   ---   -aauc   cu      c    u   -        uucu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 28232667-28232756 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-34
aga-mir-277chr2R: 28234523-28234612 [-]
aga-mir-34chr2R: 28232667-28232756 [-]
Database links

Mature sequence aga-miR-34

Accession MIMAT0005526
Sequence

17 - 

uggcagugugguuagcuggu

 - 36

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).