Stem-loop sequence aga-mir-1175

AccessionMI0006238 (change log)
DescriptionAnopheles gambiae miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Literature search

4 open access papers mention aga-mir-1175
(7 sentences)

Stem-loop
           a     -    u     uc  a      ag u 
5' gauaugga uaagu ggag agugg  uc ucgcuu  c u
   |||||||| ||||| |||| |||||  || ||||||  |  
3' cuauacuu auuca ccuc ucauc  ag agugaa  g c
           a     g    u     uu  -      aa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 9129786-9129865 [+]
intergenic
Clustered miRNAs
< 10kb from aga-mir-1175
aga-mir-1174chr2R: 9129499-9129675 [+]
aga-mir-1175chr2R: 9129786-9129865 [+]
Database links

Mature sequence aga-miR-1175

Accession MIMAT0005525
Sequence

49 - 

ugagauucuacuucuccgacuuaa

 - 72

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).