Stem-loop sequence tae-MIR444a

AccessionMI0006178 (change log)
Previous IDstae-MIR444
DescriptionTriticum aestivum miR444 stem-loop
Gene family MIPF0000402; MIR444
Literature search

12 open access papers mention tae-MIR444a
(30 sentences)

Stem-loop
   ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------gacucgagauaugcaugu  c    c     a       a         u             g        -  acaccugcauuacuugcaaaca 
5'                                                                                                                                                                                                                                                          gg ggca cgagc ugaggca caacugcau acuugcggggaag cgcaagua gg                      a
                                                                                                                                                                                                                                                            || |||| ||||| ||||||| ||||||||| ||||||||||||| |||||||| ||                       
3'                                                                                                                                                                                                                                                          cc ccgu guucg acuccgu guugacgua ugaacguucuuuc guguucau cc                      g
   acuauauagauauguacaacgauggacggucaucuacuuuuguauucauaagaugacggaacgaagauuguacacguauacgucaacagcucauuaauauaacgaaauuuaaucgugucauucgguuaguaaagaucuaguuaaaacaucuuguacaaaauuucaaaucccuuugauugucuugaaauacaaaaauuucaaaucccuuugauugucuugaaauacaaaaaagacuaucgaaaccguuuc  u    c     a       c         c             g        a  acuagaagauaauuaaaacgcg 
Get sequence
Deep sequencing
26340 reads, 74.1 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR444a

Accession MIMAT0005351
Previous IDstae-miR444
Sequence

153 - 

uugcugccucaagcuugcugc

 - 173

Get sequence
Deep sequencing21931 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).