Stem-loop sequence tae-MIR399

AccessionMI0006176 (change log)
DescriptionTriticum aestivum miR399 stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention tae-MIR399
(73 sentences)

Stem-loop
   ucgugugugaaucaca     c      c        guggcaugcauguacauaugauggugguagccu 
5'                 gggcg uucucc uuggcacg                                 g
                   ||||| |||||| ||||||||                                  
3'                 cccgu aagagg aaccgugc                                 g
   ----------------     u      a        gugccgaacgaucguucgacguggcgugcgagu 
Get sequence
Deep sequencing
47907 reads, 208 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
1A: 229092696-229092821 [-]
intergenic
Database links

Mature sequence tae-miR399

Accession MIMAT0005349
Sequence

108 - 

ugccaaaggagaauugccc

 - 126

Get sequence
Deep sequencing37325 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).