Stem-loop sequence tae-MIR167a

AccessionMI0006174 (change log)
Previous IDstae-MIR167
DescriptionTriticum aestivum miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

28 open access papers mention tae-MIR167a
(136 sentences)

Stem-loop
   ----------c       ----     c      a      a   ------------     uagc 
5'            ugcccaa    gggaa gaguga gcugcc gca            ugauc    u
              |||||||    ||||| |||||| |||||| |||            |||||    c
3'            acggguu    cccuu uucacu cgacgg cgu            acuag    c
   ucuucaucaac       gccg     c      c      -   cgcaaagaacaa     ugag 
Get sequence
Deep sequencing
1289923 reads, 6.13e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR167a

Accession MIMAT0005347
Previous IDstae-miR167
Sequence

18 - 

ugaagcugccagcaugaucua

 - 38

Get sequence
Deep sequencing1289896 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).