Stem-loop sequence tae-MIR164

AccessionMI0006173 (change log)
DescriptionTriticum aestivum miR164 stem-loop
Gene family MIPF0000045; MIR164
Literature search

30 open access papers mention tae-MIR164
(181 sentences)

Stem-loop
             c             c  uuucca  u    auuc      uc       ccggcugccgcggccuugccu 
5' gguggagaag agggcacgugcau ca      gc cggc    ccggcg  cggccgg                     g
   |||||||||| ||||||||||||| ||      || ||||    ||||||  |||||||                      
3' ccaccucuuc uuccguguacgua gu      cg gccg    ggccgc  gccggcc                     g
             u             c  ---ucc  -    --gc      gu       uagcucgcugcgugauggguc 
Get sequence
Deep sequencing
4504 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence cloned in [1] has a U residue at position 14, which is incompatible with the EST assembly and the hairpin shown here.

Database links

Mature sequence tae-miR164

Accession MIMAT0005346
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Deep sequencing3780 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).