|
miRBase |
|
Stem-loop sequence rno-mir-488 |
|||||
| Accession | MI0006168 | ||||
| Description | Rattus norvegicus miR-488 stem-loop | ||||
| Gene family | MIPF0000318; mir-488 | ||||
| Stem-loop |
--aa c cu c u a c - u uc ucu cc aga aauggc cu ucaaacaa gu u || ||| || ||| |||||| || |||||||| || ag aga gg ucu uugucg ga aguuuguu ca c ucuc a cu u - - a a u |
||||
| Comments |
The predominant miRNA cloned by Landgraf et al. has a 3' additional U residue, which is incompatible with the genome sequence [1]. |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence rno-miR-488-5p |
|
| Accession | MIMAT0017320 |
| Previous IDs | rno-miR-488* |
| Sequence |
11 - cccagauaauggcacucucaa - 31 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
Mature sequence rno-miR-488-3p |
|
| Accession | MIMAT0005341 |
| Previous IDs | rno-miR-488 |
| Sequence |
49 - uugaaaggcuguuucuugguc - 69 |
| Evidence | experimental; cloned [1], SOLiD [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|