Stem-loop sequence rno-mir-92b

AccessionMI0006167 (change log)
DescriptionRattus norvegicus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

18 open access papers mention rno-mir-92b
(132 sentences)

Stem-loop
   ---  u    a     ga       c            uucuu 
5'    gg gggc ggagg  cgggacg ggugcaguguug     u
      || |||| |||||  ||||||| ||||||||||||     c
3'    cc cccg ccucc  gcccugc ucacguuauaac     c
   gcu  -    g     -g       -            cgucc 
Get sequence
Deep sequencing
2351827 reads, 1.46e+03 reads per million, 498 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 188541034-188541116 [-]
intergenic
Database links

Mature sequence rno-miR-92b-5p

Accession MIMAT0017319
Previous IDsrno-miR-92b*
Sequence

11 - 

agggacgggacgcggugcaguguu

 - 34

Get sequence
Deep sequencing422 reads, 76 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-92b-3p

Accession MIMAT0005340
Previous IDsrno-miR-92b
Sequence

52 - 

uauugcacucgucccggccucc

 - 73

Get sequence
Deep sequencing2351402 reads, 498 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).