Stem-loop sequence rno-mir-873

AccessionMI0006166 (change log)
DescriptionRattus norvegicus miR-873 stem-loop
Gene family MIPF0000390; mir-873
Literature search

5 open access papers mention rno-mir-873
(9 sentences)

Stem-loop
   --   u ca   g a         g        a  ga 
5'   gug g  uuu c ggaacuugu agucuccu uu  a
     ||| |  ||| | ||||||||| |||||||| ||  a
3'   cac c  aag g ccuugaaca ucagagga ag  a
   aa   c ac   g c         g        c  gu 
Get sequence
Deep sequencing
41431 reads, 27.4 reads per million, 219 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 52481076-52481152 [-]
intergenic
Database links

Mature sequence rno-miR-873-5p

Accession MIMAT0005339
Previous IDsrno-miR-873
Sequence

11 - 

gcaggaacuugugagucuccu

 - 31

Get sequence
Deep sequencing37390 reads, 213 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-873-3p

Accession MIMAT0017318
Previous IDsrno-miR-873*
Sequence

47 - 

gagacugacaaguucccggga

 - 67

Get sequence
Deep sequencing4039 reads, 98 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).