Stem-loop sequence rno-mir-760

AccessionMI0006164 (change log)
DescriptionRattus norvegicus miR-760 stem-loop
Gene family MIPF0000395; mir-760
Literature search

6 open access papers mention rno-mir-760
(32 sentences)

Stem-loop
   --g   cg    c    u      ac       c    acc 
5'    gcg  ucgc cccc caggcc  cagagcc ggau   u
      |||  |||| |||| ||||||  ||||||| ||||   c
3'    cgu  agcg gggg gucugg  gucucgg cuua   a
   caa   aa    a    u      --       -    aag 
Get sequence
Deep sequencing
7487 reads, 0.588 reads per million, 340 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 225873354-225873433 [-]
intergenic
Database links

Mature sequence rno-miR-760-5p

Accession MIMAT0005336
Sequence

12 - 

ccccucaggccaccagagcccg

 - 33

Get sequence
Deep sequencing267 reads, 100 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-760-3p

Accession MIMAT0005337
Sequence

49 - 

cggcucugggucugugggga

 - 68

Get sequence
Deep sequencing6723 reads, 297 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).