Stem-loop sequence rno-mir-743a

AccessionMI0006162 (change log)
DescriptionRattus norvegicus miR-743a stem-loop
Gene family MIPF0000386; mir-743
Literature search

2 open access papers mention rno-mir-743a
(9 sentences)

Stem-loop
   --u  ag    g       a      c  g    guuu 
5'    gc  ugcu uauucag uuggug cu ucau    a
      ||  |||| ||||||| |||||| || ||||     
3'    cg  guga auggguc aaccgc ga agua    u
   acu  ag    g       a      a  a    agaa 
Get sequence
Deep sequencing
9624 reads, 223 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 151252828-151252903 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-743a
rno-mir-883chrX: 151260703-151260779 [-]
rno-mir-742chrX: 151260313-151260389 [-]
rno-mir-743bchrX: 151253318-151253394 [-]
rno-mir-743achrX: 151252828-151252903 [-]
Database links

Mature sequence rno-miR-743a-5p

Accession MIMAT0017315
Previous IDsrno-miR-743a*
Sequence

11 - 

uauucagauuggugccugucau

 - 32

Get sequence
Deep sequencing4318 reads, 79 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-743a-3p

Accession MIMAT0005334
Previous IDsrno-miR-743a
Sequence

45 - 

gaaagacgccaaacuggguaga

 - 66

Get sequence
Deep sequencing5304 reads, 75 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).